Новые разработки лада: изображения и характеристики :: Autonews

Содержание

новый бренд и новые модели

В 2004 году автомобили LADA приняли участие в крупнейших международных и российских автосалонах, серийные и перспективные модели АВТОВАЗа демонстрировались и во время »передвижных выставок» — автопробегов. Таким образом, продолжалась реализация новой маркетинговой политики автогиганта и продвижение бренда LADA. Подробнее об этом рассказывает начальник центра управления массовыми коммуникациями ОАО »АВТОВАЗ» Александр Егошин.

— Ежегодно автомобили LADA участвуют в нескольких десятках автовыставок, как в пределах России, так и за рубежом. Наиболее крупные и яркие автошоу, на которых демонстрируется серийная продукция АВТОВАЗа и его потенциал — это такие автосалоны, как Женевский, который по традиции открывает выставочный год, автошоу в Париже, Лейпциге, Москве, Киеве. Кстати, Лейпцигская ярмарка сегодня имеет для нас особое значение: в 2005 году изменится формат проведения автосалона в Лейпциге, расширятся его площади, резко увеличится состав участников.

В 2004 году на каждом крупном автосалоне демонстрировались как серийные и мелкосерийные автомобили, так и перспективные разработки АВТОВАза. К последним относятся представители семейства LADA KALINA, LADA PRIORA. В ушедшем году публике был представлен концепт-кар »Силуэт». Демонстрировались и другие проекты, например, экологически чистый автомобиль на топливных элементах LADA ANTEL. Как и в прошлых выставочных сезонах, в 2004 году АВТОВАЗ показал модели и модификации, которые имеют реальную перспективу. Так, производство LADA KALINA уже запущено. А автомобиль LADA REVOLUTION, который в 2003 году был представлен в качестве прототипа, сейчас стал боевым болидом, который открыл новый класс в отечественном автоспорте.

В прошлом году АВТОВАЗ принял участие в ряде российских региональных автосалонов. Эти мероприятия проводили предприятия фирменной сервисно-сбытовой сети при поддержке автозавода. Дилеры и дистрибьюторы получили рекламно-сувенирную продукцию, видеоматериалы, рекомендации по сценарию проведения выставки. Также АВТОВАЗ готовил для участия в региональных автосалонах отдельные образцы новой техники. В 2004 году в 10 городах в качестве »гвоздя программы» прошла презентация LADA KALINA. Эту практику демонстрации новой техники мы будем продолжать и дальше, причем значительно расширяя географию показа последних разработок АВТОВАЗа. На каждом региональном автосалоне работали специалисты и руководители АВТОВАЗа. Были организованы официальные встречи представителей завода с руководством местных предприятий дилерской сети, проводились пресс-конференции. На местах отмечали, что реформы в сервисно-сбытовой сети происходят стремительно, и их результаты хорошо заметны. Возросла активность дилеров в организации презентационных мероприятий, во внедрении фирменного стиля. В 2005 году, с ростом производства LADA KALINA, кампания по продвижению новой модели и бренда LADA в целом станет еще масштабнее. Сегодня и внешний вид многих дилерских центров, и интерьер соответствуют требованиям фирменного стиля. Магазины по продаже сувенирно-полиграфической продукции и аксессуаров к автомобилям, а также наружная реклама — наличие всего этого уже предусмотрено дилерскими соглашениями. Необходимые имиджевые товары дилеры могут заказать по новым каталогам 2005 года.

Что касается других рекламно-имиджевых мероприятий, то в 2004 году АВТОВАЗ организовал собственный корпоративный автопробег »Дальневосточный маршрут-2004» и принял участие в ряде мероприятий, проведенных другими структурами и средствами массовой информации. Техника АВТОВАЗа отлично показала себя в пробегах, которые организовали журнал »За рулем» и Авторадио.

Некоторые дилеры, например, в Краснодарском крае, в Северо-западном регионе, самостоятельно проводят автопробеги по своим территориям. Со стороны АВТОВАЗа им оказывается методическая поддержка. В 2005 году региональных пробегах будут участвовать автомобили LADA KALINA.

Автопробег на Дальний Восток, организованный непосредственно АВТОВАЗом, имел целью продвижение торговой марки LADA и поддержание имиджа сервисно-сбытовой сети. В последние 2-3 года внимание к вазовской продукции повысилось: люди видят, что наши автомобили значительно продвинулись по оснащенности и качеству. Ниша для автомобилей LADA на дальневосточном рынке существует.

Группа «АВТОВАЗ» является частью бизнес-подразделения Dacia-LADA в структуре Renault Group. Компания производит автомобили по полному производственному циклу и комплектующие для 2-х брендов: LADA и Renault. Производственные мощности АВТОВАЗа расположены в Тольятти – АО «АВТОВАЗ», а также в Ижевске – ООО «LADA Ижевск».

Продукция марки LADA представлена в сегментах В, B+, SUV и LCV и состоит из 5 семейств моделей: Vesta, XRAY, Largus, Granta и NIVA. Бренд лидирует на российском автомобильном рынке с долей более 20% и представлен в 12 странах. LADA имеет самую большую официальную дилерскую сеть в России – 300 дилерских центров.

АВТОВАЗ рассказал о перспективах модели LADA Vesta

АВТОВАЗ в перспективе откажется от собственной платформы LADA B/C, на которой построена флагманская модель LADA Vesta. Как пояснили на АВТОВАЗе, LADA B/C не может обеспечить модульного подхода, позволяющего создавать на ней легковые автомобили и кроссоверы разных классов. К тому же она не обладает электронной архитектурой, необходимой для внедрения элементов телематики и современных систем активной безопасности и контроля, пишет «Российская газета».

«Доработка платформы LADA B/C до современных стандартов заняла бы несколько лет и потребовала бы глобальных инвестиций, значительно превышающих затраты на переход на иностранную современную платформу. Текущее состояние российского автомобильного рынка и прогнозы его развития делают этот проект неэффективным ввиду отсутствия эффекта масштабирования даже в среднесрочной перспективе», – констатируют на АВТОВАЗе.

Между тем, в настоящее время АВТОВАЗ ведет активную работу над рестайлингом автомобилей флагманского семейства LADA Vesta. Запуск серийного производства новинки состоится не ранее 2022 года, более точные сроки пока не определены. Напомним, завод «ЛАДА Ижевск» производит седан LADA Vesta, универсал LADA Vesta SW и их кросс-версии LADA Vesta Cross и LADA Vesta SW Cross.

По итогам четырех месяцев 2021 года реализация семейства LADA Vesta на российском рынке составила 35049 машин, что на 18% выше показателя за аналогичный период прошлого года. В результате модель занимает вторую строчку в рейтинге самых продаваемых автомобилей LADA в России (после LADA Granta).

Как ранее сообщал «АВТОСТАТ», в январе 2021 года Группа Renault в рамках нового стратегического плана «Ренолюция» (Renaulution) создала новое бизнес-подразделение Dacia-LADA, что укрепит производственные синергии между брендами за счет использования высококонкурентной по стоимости и гибкой платформы CMF-B в сочетании с самым высоким коэффициентом локализации. АВТОВАЗ и Dacia останутся отдельными компаниями со своей собственной историей и стратегией, которые вместе будут выпускать ежегодно более 1 млн автомобилей на базе CMF-B, перейдя с 4 платформ на одну и сократив количество типов кузовов с 18 до 11.

К 2025 году АВТОВАЗ выведет на рынок четыре новых модели LADA, которые будут базироваться на платформе CMF-B. Так, на 2023 год запланирован выход двух моделей В-класса: по неофициальным данным, речь идет о новом поколении LADA Granta в кузовах «седан» и «универсал». В 2024 году появится новое поколение внедорожника Niva, который получит две версии – с компактной и удлиненной колесной базой. Новая Niva будет поставляться на экспорт и появится, в частности, на рынках стран Европы и Латинской Америки. А в 2025 году в модельном ряду LADA появится новый автомобиль сегмента С-SUV.

Какие модели можно точно ждать на российском рынке в ближайшие месяцы – смотрите в «Календаре новинок».

Фото: АВТОВАЗ

АВТОВАЗ: 35 лет научно-техническому центру — Пресс-релизы — Новости

4 сентября исполняется 35 лет с момента выхода правительственного постановления о создании на АВТОВАЗе отраслевого научно-технического центра. Комплекс конструкторских служб и лабораторий, многие из которых уникальны в масштабах страны, успешно работает и сегодня – и является основой службы инжиниринга АВТОВАЗа.

Служба инжиниринга АВТОВАЗа – это не только комплекс лабораторий, но и сложившийся высокопрофессиональный коллектив, способный решать сложные задачи. Потенциал и компетенции НТЦ АВТОВАЗа высоко ценится в рамках Renault Group. Именно поэтому принято решение, что АВТОВАЗ и его инженеры внесут значительный вклад в план Renaulution – новую стратегию развития Renault Group. LADA планирует усилить свой продуктовый план пятью новыми моделями до 2025 года, включая новое семейство автомобилей B-сегмента и полностью новое поколение Niva. При этом будет использована высококонкурентная по стоимости и гибкая платформа Альянса CMF-B, которую планируется в значительной степени локализовать. Одновременно с проектированием новых автомобилей проводится модернизация выпускаемых моделей: внедряются новые системы безопасности и комфорта, в частности, это сервисы подключенных автомобилей.

Реализация новых проектов потребует усиление инженерного потенциала АВТОВАЗа. Для развития компетенций службы инжиниринга и реализации среднесрочного плана обновления модельного ряда LADA, Компания укрепляет кооперацию с ВУЗами как в Самарской области, так и за ее пределами, популяризирует автомобильную индустрию в молодежной студенческой среде. Сегодня генеральные договоры о сотрудничестве заключены с университетами Тольятти, Самары, Томска, Санкт-Петербурга и Москвы. АВТОВАЗ продолжает набор как выпускников вузов, так и высококвалифицированных специалистов: с 2017 года на завод устроилось работать более тысячи молодых сотрудников из разных регионов России.

НТЦ: история

Конструкторская служба АВТОВАЗа начала формироваться еще в конце 1960-х гг, в период запуска автозавода и освоения первой модели, ВАЗ-2101 – модернизация лицензионного автомобиля проходила с участием вазовских инженеров. С тех пор были реализованы и другие значимые для страны проекты, среди которых – развитие «классического» заднеприводного семейства, разработка автомобиля «Нива», переднеприводного семейства «Самара». Проведена работа над концептуальными проектами, в частности, над автомобилями на альтернативных источниках энергии – эти и многие другие проекты сегодня демонстрируются в корпоративном музее АВТОВАЗа в Тольятти.

В 1986 году служба главного конструктора АВТОВАЗа начала трансформацию в отраслевой научно-технический центр – сохранив ключевые компетенции, подразделение получило новые возможности и материально-техническую базу. Проект НТЦ создавали специалисты, которым впоследствии предстояло здесь работать. Многие объекты (аэродинамическая труба, аэроклиматический комплекс, комплекс электромагнитной совместимости, камера по исследованию шумов) были созданы с использованием передового мирового опыта.

В концепции НТЦ был заложен мощный потенциал для разработки новых моделей и организации технологической подготовки процессов их производства. Как и все производство АВТОВАЗа, инжиниринговый центр в настоящее время проходит трансформацию в соответствии со стандартами Renault Group.

НТЦ: основные лаборатории

Для проектирования автомобилей в службе инжиниринга АВТОВАЗа работает комплекс подразделений, где создаются все основные узлы и агрегаты: кузов, двигатель, трансмиссия, подвеска, интерьер, электрооборудование и тд. Все создаваемые концепции проверяются на дорогах и в испытательных лабораториях.

Комплекс испытательных автодорог: одним из основных его объектов является скоростная кольцевая профилированная трасса протяженностью 10 километров, имеющая овальную форму и ширину проезжей части 12 метров. Максимальная скорость, на которой могут проводиться испытания, составляет 325 км/ч. Внутри овала расположен комплекс специальных дорог для проверки и настройки управляемости, уровня комфорта, шумов, вибраций. Здесь анализируется поведение автомобиля в летних и зимних условиях, проводятся топливно-скоростные и ресурсные испытания. Часть этих трасс изолирована от воздействия внешней среды, что повышает точность результатов тестов.

Аэродинамическая труба, единственная лаборатория такого класса в России, и одна из немногих в мире, позволяет производить испытания автомобилей разных классов, а также других объектов, например, макетов зданий. Вентилятор диаметром в 7,4 метра создает поток воздуха скоростью до 216 км/час. Прижимную или подъемную силы измеряют весы – настолько чувствительные, что, если на автомобиль положить монету, система покажет изменения показателей. В аэродинамическом комплексе результате можно не только произвести необходимые замеры сил и моментов, действующих на объект, но и выработать рекомендации по оптимизации поверхностей.

Аэроклиматическая камера позволяет испытывать автомобиль в различных климатических условиях, независимо от времени года. Внутри камеры можно имитировать мороз, жару, тропический ливень, снегопад. Это позволяет оперативно испытывать различные системы автомобиля, например, оценить эффективность работы климатической установки или системы обогрева зеркал.

Камера испытаний на электромагнитную совместимость: здесь проверяют и совершенствуют электрооборудование автомобилей. В лаборатории электромагнитной совместимости АВТОВАЗа действует экранированная безэховая камера – одна из самых больших в мире, что позволяет вести исследования в широком диапазоне волн. Стены камеры покрыты пирамидами-абсорберами, которые гасят и звуки, и электромагнитные волны. В лаборатории возможна имитация электромагнитных полей практически от любых существующих источников, от сотовых телефонов, до высоковольтной ЛЭП.

Лаборатория виброакустических испытаний представляет собой автономное сооружение: специальный фундамент комплекса изолирует его от возможных шумов и вибраций извне. В испытательных камерах можно тестировать автомобиль в разных режимах движения, при этом стены лаборатории покрыты специальным звукопоглощающим материалом, исключающим возможность появления эха. Все это позволяет с максимальной точностью рассчитывать уровень шума, издаваемого автомобилем, а также шумов внутри него.

Лаборатория краш-тестов – это лучший из 2-х комплексов ударных испытаний, имеющихся в России. Здесь можно смоделировать большинство сценариев столкновений, которые случаются в реальной жизни, а также проводить омологационные и сертификационные испытания. В частности, это фронтальный удар о жесткий или деформируемый барьер, удар в автомобиль сбоку и сзади, удар о столб. Высокоточное оборудование, а также интерактивные манекены последнего поколения позволяют получить исчерпывающую информацию о повреждениях самого автомобиля и его пассажиров – это дает возможность проектировать автомобили в соответствии с высокими стандартами безопасности. Помимо испытаний LADA, служба инжиниринга АВТОВАЗа проводит тесты других автомобилей по заказам партнеров, а также испытания автокомпонентов – для отбора комплектующих изделий необходимого качества.

_______

Дополнительная информация

За 35 лет в НТЦ были созданы следующие проекты серийных автомобилей: семейство LADA 110 (1995-2007), ВАЗ-2123 (Niva, второе поколение, производство с 2000 года), семейство LADA Kalina (2004-2011), LADA Priora (2007-2018), семейство LADA Granta (производство с 2011 года), LADA Vesta (производство с 2015 года), LADA XRAY (производство с 2015 года).

Новые модели АвтоВАЗ в стиле XRay появятся в 2015 году » Авто-реактор

11 Июнь 2013

Размещено в: ВАЗ, Новости |

 

 

Принципиально новые модели АвтоВАЗа, соответствующие концепции XRay, впервые появятся в 2015 году. Первыми моделями, соответствующими новому стилю, станут кроссовер и высокий хэтчбек гольф-класса. В последующие два года модельный ряд новых автомобилей будет расширен. При выпуске новых автомобилей АвтоВАЗ будет ориентироваться прежде всего на интересы отечественного потребителя, с учетом состояния дорог и окружающей среды. Также все новые модели АвтоВАЗа будут иметь тесную связь с концептом Lada XRAY, который впервые был представлен на Московском автосалоне в сентябре 2012 года. В разработке дизайна одной из новых моделей недавно приняли участие студенты из Московского государственного машиностроительного университета (МАМИ).

 

 

Напомним, что недавно АвтоВАЗ совместно с МАМИ организовал конкурс на разработку дизайна новых ВАЗовских моделей. Итоги конкурса подвели руководитель московской студии Томас Бигувуд и главный дизайнер тольяттинского автозавода Стив Маттин. Среди 17 работ, представленных на конкурс, первое место занял проект студента 5-го курса Московского государственного машиностроительного университета Дмитрия Почашева, второе место занял Арсений Михеев, также студент 5-го курса МАМИ, а 3-е место досталось студенту 3-го курса Петру Коновалову.

Проекты студентов оценивались по нескольким критериям:
— уровень проведённого исследования;
— творческий уровень;
— соответствие направлению развития бренда Lada;
— качество пропорций;
— качество презентации, в частности устное выступление и графическое сопровождение.

Победители конкурса смогут пройдут стажировку в дизайн-студии тольяттинского автопредприятия.

Запись опубликована 11.06.2013 в 17:22 и размещена в разделе ВАЗ, Новости. Вы можете читать комментарии, используя RSS-ленту. Вы можете оставить комментарий. Оповещения с сайтов отключены.

когда ВКС России получат на вооружение тяжёлый ударный БПЛА «Охотник» — РТ на русском

На Новосибирском авиационном заводе состоялась выкатка первого лётного образца новейшего российского ударного беспилотника «Охотник» с плоским реактивным соплом. Об этом сообщил замминистра обороны РФ Алексей Криворучко. По его словам, выкатка БПЛА фиксирует завершение сборки изделия в целом, оснащение его всем необходимым бортовым оборудованием и переход к комплексным наземным отработкам для подготовки к первому вылету.

Эксперты отмечают, что работа над проектом продолжается в плановом порядке и в ближайшие годы «Охотник» поступит на вооружение ВС РФ.

На Новосибирском авиационном заводе имени Чкалова состоялась выкатка первого лётного образца российского ударного беспилотника С-70 «Охотник» с плоским реактивным соплом двигателя. В мероприятии принял участие замглавы Минобороны РФ Алексей Криворучко, также проинспектировавший процесс сборки второго лётного экземпляра.

«Выкатка БПЛА фиксирует завершение сборки изделия в целом, оснащение его всем необходимым бортовым оборудованием в соответствии с требованиями, предъявляемыми к летательным аппаратам, и переход к комплексным наземным отработкам для подготовки к первому вылету», — заявил замминистра обороны РФ.

Новый лётный образец отличается формой сопла двигателя, изменённой с круглой на плоскую. Гендиректор корпорации «Ростех» Сергей Чемезов назвал это главной особенностью БПЛА и отметил, что благодаря новой конструкции была снижена радиолокационная заметность машины.

 

Кроме того, Чемезов сообщил, что для «Охотника» создаётся новый наземный пункт управления, разработанный с учётом требований военных. По словам гендиректора «Ростеха», это решение, как и создание плоского сопла, значительно повысит возможности БПЛА.

В свою очередь, Криворучко отметил, что производство беспилотников такого уровня доступно только странам с развитой авиационной промышленностью.

Также по теме

«Сможет вести разведку автономно»: какими возможностями будет обладать ударный беспилотник ВКС «Охотник»

В России впервые поднялся в воздух тяжёлый разведывательно-ударный беспилотный комплекс «Охотник». Об этом сообщили в Минобороны РФ….

«Производить БПЛА данного класса способны только страны с развитой авиационной промышленностью, обеспечивающей проведение полного цикла разработки — от проектирования до изготовления и проведения всех видов испытаний, а также разработку и производство всего необходимого наземного и бортового оборудования.

.. Беспилотные летательные аппараты такого класса невозможно собрать из комплектующих изделий, доступных на рынке, как, скажем, ряд зарубежных аналогов», — подчеркнул он.

По словам замминистра обороны, «Охотник» представляет собой высокоинтеллектуальную систему, способную решать широкий круг задач одиночно, группой и совместно с самолётами пилотируемой авиации.

«В БПЛА сконцентрированы передовые достижения предприятий и организаций отечественного оборонно-промышленного комплекса, позволившие обеспечить функциональные возможности, не уступающие, а по ряду параметров превосходящие немногочисленные иностранные аналоги», — рассказал Криворучко, добавив, что серийный контракт на поставки «Охотника» будет заключён в течение полугода.

«На сегодня уже достаточно серьёзно комплекс готов к серийному производству. Хотелось бы добавить, что в ближайшее время мы уже заключим серийный контракт на поставку этих машин. Эти машины всё-таки испытательные, но в течение полугода мы заключим серийный контракт, опережающий поставку этих беспилотных аппаратов», — подчеркнул он.

Ранее глава ОАК Юрий Слюсарь высказывал предположение, что Минобороны начнёт получать серийные БПЛА «Охотник» в 2024 году.

Тяжёлый «Охотник»

С-70 «Охотник» разработки ОКБ Сухого — первый тяжёлый ударный БПЛА отечественного производства. Его создание началось в 2012 году. Первый макет аппарата для проведения наземных испытаний был создан в 2014-м.

Впервые опытный образец «Охотника» был представлен в 2018 году, когда БПЛА вышел на завершающий этап наземных испытаний. Позднее ТАСС со ссылкой на источники в ОПК сообщил, что «Охотник» в ходе этих испытаний совершил первую пробежку по взлётно-посадочной полосе Новосибирского авиационного завода, достигнув скорости 200 км/ч. При этом, отмечал источник, руление, разбег, набор скорости и остановка в конце полосы были выполнены «Охотником» полностью автономно.

  • С-70 «Охотник»
  • © ОАК

Первый испытательный полёт БПЛА совершил в августе 2019 года. Он продолжался более 20 минут — «Охотник» под управлением оператора выполнил несколько облётов аэродрома на высоте около 600 м и совершил успешную посадку.

Также по теме

Новые возможности: какими будут российские ударные и разведывательные БПЛА «Альтиус» и «Форпост»

Минобороны России и Уральский завод гражданской авиации (УЗГА) заключили контракт на создание разведывательно-ударного беспилотника…

Позднее, в конце сентября 2019 года, Минобороны РФ сообщило о первом совместном полёте «Охотника» и истребителя пятого поколения Су-57. В ходе этого испытания БПЛА в автоматизированном режиме отработал взаимодействие с самолётом-лидером по расширению радиолокационного поля истребителя, а также целеуказания для применения средств поражения большой дальности без захода Су-57 в зону условного противодействия ПВО.

«Охотник» выполнен по схеме «летающее крыло». Внешне он напоминает уменьшенные версии американских бомбардировщика B-2 Spirit и БПЛА Northrop Grumman X-47B. Тактико-технические характеристики «Охотника» не раскрываются.

Согласно данным из открытых источников, его максимальная взлётная масса составляет 20 т, радиус действия — 3,5 тыс. км, максимальная скорость — около 1000 км/ч, высота полёта — до 10,5 км. Без дозаправки БПЛА сможет находиться в воздухе более суток.

Разработка Россией нового тяжёлого беспилотника привлекла внимание и западного экспертного сообщества. Так, американский военно-политический портал The National Interest в своём материале «Встречайте: российский тяжёлый ударный стелс-БПЛА «Охотник» отмечал перспективы использования этих машин в связке с истребителями.

Эксперты The National Interest отмечали, что эта технология может существенно снизить время отклика благодаря установлению прямой связи или обеспечения командования и контроля между воздушными платформами, тем самым исключая необходимость передавать сигнал через наземную станцию.

«Это расширит возможности для рекогносцировки и, что ещё более важно, может позволить пилоту истребителя пятого поколения работать на безопасном расстоянии от зоны поражения, командуя, управляя и проводя атаки на передовой тяжеловооружённым БПЛА. «Охотник» может действовать и наносить удары в зонах заметно повышенной опасности, хорошо защищённых летательными аппаратами и средствами противовоздушной обороны», — пишет американское издание.

Новые доработки 

Редактор газеты «Независимое военное обозрение» Дмитрий Литовкин в разговоре с RT обратил внимание, что в Новосибирске состоялась выкатка доработанной версии беспилотника, оснащённого новым, плоским соплом, существенно снижающим его заметность.

«Раньше сопло двигателя у «Охотника» было круглым. Однако конструкторы и военные работают над понижением радиолокационной заметности этой машины и пытаются достичь тех требований, которые к ней предъявлялись, — возможности не только группового действия в составе пилотируемых комплексов, но и выполнения самостоятельных деликатных миссий в глубоком тылу противника», — подчеркнул эксперт.

Современные условия ведения боя постоянно эволюционируют, и применение ударных беспилотников в различных военных операциях приобретает всё большую актуальность, пояснил Литовкин.

Также по теме

Ударный «Орион»: как новые беспилотники усилят Вооружённые силы России

Министерство обороны России впервые опубликовало фото ударного беспилотника «Орион». На нём БПЛА демонстрируется в пустынном камуфляже…

«Мы видели результаты конфликта в Нагорном Карабахе, где турецкие БПЛА Bayraktar сыграли, наверное, решающую роль в обеспечении победы Азербайджана над Арменией. Понятно, что такая техника нужна и российским военным, потому что в некоторых ситуациях гонять самолёт с пилотом, рискуя жизнью человека, нецелесообразно. Беспилотник — вещь дорогая, но это робот, потеря которого бьёт только по кошельку», — рассказал эксперт.

В свою очередь, военный эксперт Алексей Леонков отметил, что выкатка нового лётного образца «Охотника» говорит об уверенном и плановом развитии этого проекта.

«Выкатка состоялась в новом корпусе и в новом фюзеляже, которые созданы по технологии пониженной радиоавиационной заметности. Это говорит о том, что работа выходит на финишную прямую. И скоро беспилотники поступят на вооружение нашей армии и флота», — пояснил собеседник RT.

Использование таких БПЛА позволит Вооружённым силам РФ с ещё большей эффективностью реализовывать концепцию создания так называемой зоны воспрещения доступа и манёвра, добавил Леонков.

Эта концепция, в западной военной теории называемая A2/AD, представляет собой построение различных средств ПВО, противокорабельной ракетной обороны и оперативно-тактических ракетных комплексов, которые позволяют преградить противнику доступ в критически важные районы.

«Остаётся ещё несколько испытаний, в том числе с применением оружия: БПЛА должен уметь пользоваться авиационными средствами поражения, которыми его оснастят, и поражать цели с высокой точностью. После этого будет принято решение о его приёме в ряды вооружённых сил», — заключил эксперт. expander.close}}-{{/expander.close}}

{{/children.length}} {{/href}} {{#children.length}} {{/children.length}} {{/children}} {{/children.length}} {{/.}}

Время выбирать Nokian Tyres — Безопасные зимние шины для сложных климатических условий

Огромное количество инноваций, более 100 патентов по зимним шинам и лидерство в независимых тестах год за годом сделали зимние шины Nokian Hakkapeliitta легендой.

Марка МаркаABARTHACACURAAIWAYSAIXAMALFA ROMEOALPINAALPINEAMCAROARTEGAASIA MOTORSASTON MARTINAUDIAUSTINAUSTIN-HEALEYAUTO UNIONAUTOBIANCHIAVIABARKASBAWBEDFORDBENTLEYBERTONEBESTURN (FAW)BITTERBMWBOGDANBONDBORGWARDBRILLIANCEBRISTOLBUGATTIBUICKBYDCADILLACCALLAWAYCARBODIESCATERHAMCHANGANCHANGFENGCHECKERCHERYCHEVROLETCHRYSLERCITROËNCMCCUPRADACIADAEWOODAFDAIHATSUDAIMLERDALLASDATSUNDE LOREANDE TOMASODERWAYSDODGEDONKERVOORTDRDSEMGRANDENGLONFAWFAW (TIANJIN)FENGSHENFERRARIFIATFISKERFORDFORD AUSTRALIAFORD OTOSANFORD USAFOTONFSOGAZGEELYGENESISGEOGINETTAGIOTTI VICTORIAGLASGMCGONOWGONOW (GAC)GOUPILGREAT WALLHAFEIHAIMA (FAW)HAIMA (ZHENGZHOU)HAVALHAWTAIHINDUSTANHOBBYCARHONDAHONDA (GAC)HUANGHAIHUMMERHYUNDAIINDIGOINFINITIINNOCENTIIRAN KHODROIRMSCHERISDERAISUZUIVECOIZHJACJAGUARJEEPJENSENJMCKIAKTMLADALAMBORGHINILANCIALAND ROVERLANDWIND (JMC)LDVLEXUSLIFANLIGIERLINCOLNLOTUSLTILUXGENMAHINDRAMANMARCOSMASERATIMAXUSMAYBACHMAZDAMCLARENMEGAMERCEDES-BENZMETROCABMGMG (SAIC)MICROCARMIDDLEBRIDGEMINELLIMINIMITSUBISHIMITSUOKAMORGANMORRISMOSKVICHMPM MOTORSNISSANNISSAN (DFAC)NSUOLDSMOBILEOLTCITOPELOSCAPANOZPANTHERPEUGEOTPIAGGIOPININFARINAPLYMOUTHPOLESTARPONTIACPORSCHEPREMIERPROTONPUCHRAMRANGERRAVONRAYTON FISSORERELIANTRENAULTRENAULT TRUCKSRILEYROLLS-ROYCEROVERRUFSAABSAMSUNGSANTANASEATSEAZSEVICSHELBYSHUANGHUANSIPANISKODASMARTSPECTRESPYKERSSANGYONGSTANDARD AUTOMOBILESTEYRSTREETSCOOTERSUBARUSUZUKITAGAZTALBOTTATATAZZARITESLATHINKTOFASTOYOTATOYOTA (FAW)TOYOTA (GAC)TRABANTTRIUMPHTVRUAZUMMUZ-DAEWOOVAUXHALLVECTORVOLVOVORTEXVWWARTBURGWESTFIELDWIESMANNWOLSELEYYUGOYULONZASTAVAZAZZHONGHUA (BRILLIANCE)ZHONGXING (ZX AUTO)ZILZOTYEZUENDAPP

Год выпуска Год выпуска

Модель Модель

Двигатель (опционально) Двигатель

Ширина Ширина

Высота Высота

Диаметр Диаметр

Как определить типоразмер Ваших шин

Типоразмер шин, которые подходят вашему автомобилю, обозначается набором цифр и букв, например, 205/55 R 16 94 V XL. product_list_description}} {{{description}}} {{/product_list_description}} {{#showSizes}}

    {{#sizes}}
  • индекс скорости {{kmh}} км/ч{{#speed}}{{#weight}}, {{/weight}}{{/speed}} наибольшая грузоподъемность {{kg}} kg {{#out_of_production}}
    {{/out_of_production}}
  • {{/sizes}}
{{/showSizes}} {{/showProduct}} {{#isBanner}} {{#banners}} {{/banners}} {{/isBanner}} {{/product}} {{/product. length}} {{/showFilter}} {{/items}} {{/filterGroup}}

  • Легковые автомобилиВнедорожники / 4х4Минивэны и легкие грузовикиГрузовые автомобили и автобусыИндустриальные шины

  • Зимние шины Летние шины Нешипованные шины Шипованные шины

Новинка Бессрочная Расширенная гарантия Шиномонтаж в подарок

Новые шипованные шины Nokian Hakkapeliitta 10p — это инновационное сочетание превосходного зимнего сцепления, максимального комфорта и экологичности.
Подробнее

Новинка Бессрочная Расширенная гарантия Шиномонтаж в подарок Электромобили

Новые шины Nokian Hakkapeliitta 10 EV предлагают максимальный акустический комфорт и безопасность для премиальных автомобилей и требовательных водителей.
Подробнее

Бессрочная Расширенная гарантия Шиномонтаж в подарок

Nokian Hakkapeliitta 9 — первая шипованная шина с двумя видами шипов для лучшего сцепления при разгоне и в поворотах.
Подробнее

Бессрочная Расширенная гарантия Шиномонтаж в подарок Электромобили

Нешипованная шина Nokian Hakkapeliitta R3 — это превосходный баланс безопасности, комфорта и экономичности. Благодаря строению протектора и новейшему составу резиновой смеси Nokian Hakkapeliitta R3 имеет минимальное сопротивление качению.
Подробнее

Победитель теста Бессрочная Расширенная гарантия Шиномонтаж в подарок

В шинах Nokian Hakkapeliitta 8 используется на 50% больше шипов, чем в предыдущих моделях Nokian Hakkapeliitta. Шипы распределены равномерно по всей поверхности протектора для лучшего сцепления с дорогой.
Подробнее

Победитель теста Бессрочная Расширенная гарантия Шиномонтаж в подарок

Современная фрикционная зимняя шина для водителей, которым важен абсолютный комфорт при вождении, заметно сниженный расход топлива и технология изготовления нешипованных зимних шин с наилучшими характеристиками безопасности.
Подробнее

Новинка 1 год Расширенная Гарантия Шиномонтаж в подарок

Шипованная шина Nokian Nordman 8 сбалансирована и безопасна как на льду, так и на снегу.
Подробнее

1 год Расширенная Гарантия Шиномонтаж в подарок

Новые надежные и долговечные шипованные шины Nokian Nordman 7 обеспечивают безопасное и комфортабельное вождение в сложных изменчивых климатических условиях.
Подробнее

Рисунок протектора и конструктивные решения аналогичны решениям, использованным в шине Nokian Hakkapeliitta 5. Технология «медвежий коготь», которая отлично зарекомендовала себя в шинах Nokian Hakkapeliitta, улучшает сцепление. В плечевых зонах ши…
Подробнее

1 год Расширенная Гарантия Шиномонтаж в подарок

Nokian Nordman RS2 — это сбалансированные и комфортные фрикционные зимние шины для сложных зимних условий. Надежное сцепление сохраняется в любых погодных условиях. Благодаря рисунку протектора и инновациям в резиновой смеси Nokian Nordman RS2 зан…
Подробнее

Новинка Для мягкой зимы

Зимняя шина Nokian Snowproof P обеспечивает безопасность и эффективность в те моменты, когда это нужно больше всего — точность и комфорт на сухих автострадах, надежность и устойчивость при слякоти и улучшенное сцепление на заснеженных горных дорогах.
Подробнее

Для мягкой зимы

Шина Nokian Snowproof — новый флагманский продукт от создателей зимних шин, которые знают толк в альпийской зиме и обладают арктическим опытом. Испытайте полный контроль, безопасность и сбалансированное вождение в любых условиях.
Подробнее

Для мягкой зимы Шиномонтаж в подарок Шымкент

Новая шина Nokian WR A4 оптимально сочетает в себе отличную управляемость и превосходное сцепление. Это обеспечивает сбалансированное вождение в условиях быстро изменяющихся погодных кондиций в условиях мягкой умеренно-континентальной зимы.
Подробнее

Победитель теста Для мягкой зимы Шиномонтаж в подарок Шымкент

Nokian WR D4 — это универсальная зимняя шина, разработанная для безопасной и сбалансированной езды на мокрой и заснеженной дороге.
Подробнее

Михаил Полубояринов: по итогам года группа «Аэрофлот» увеличит перевозки на 50%

14:06 / 23. 12.21

Михаил Полубояринов © Станислав Красильников/ТАСС

Текущий год для группы «Аэрофлот» стал значительно лучше прошлого, но говорить о прибыли преждевременно, поскольку международный рынок восстановился не более чем на 30%. Об основных факторах, которые будут оказывать влияние на финансовые показатели в 2022 году, о том, чем удобен механизм демпфера на авиакеросин, и о планах расширения российского авиапарка группы в интервью ТАСС рассказал генеральный директор «Аэрофлота» Михаил Полубояринов. 

— Мы беседуем во второй половине декабря, и самый важный вопрос — с какими итогами вы приходите к новому году?

— Рынок медленно, но восстанавливается. Внутренние рынки в больших странах, таких как Россия, Китай, восстанавливаются быстрее, чем международные. Об этом многократно говорили аналитики, много раз подтверждали другие перевозчики.

Примечательно, что темпы восстановления внутреннего рынка в России опережают аналогичные показатели других стран с крупными внутренними рынками, включая Китай, США. Здесь мы в первую очередь говорим о восстановлении объемов рынка, доходность перевозок при этом по-прежнему ниже уровней 2019 года на фоне существенного прироста провозных емкостей. Зарубежные рынки закрыты, часть флота не задействована, многие авиакомпании вынуждены использовать самолеты на внутренних маршрутах.

Тем не менее «Аэрофлот», авиакомпании нашей группы, другие отечественные перевозчики сохранили финансовую стабильность за счет активности внутреннего рынка. Кроме того, нужно сказать спасибо государству, правительству за комплекс мер по поддержке отрасли. 

— А мировой рынок? 

— Здесь наш прогноз также совпадает с прогнозами международных аналитиков: полного восстановления вряд ли стоит ожидать ранее 2024 года. Надеемся, что российский рынок восстановится уже в 2022-м. Но перевозки «Аэрофлота» на международных линиях вернутся к прежним объемам, думаю, ближе к 2024 году.

— Есть понимание, с каким результатом по пассажиропотоку закончите 2021 год? 

— По итогам года группа «Аэрофлот» перевезет порядка 46 млн пассажиров. Это неплохой результат.  

— Какие ключевые задачи стоят перед авиакомпанией и перед группой «Аэрофлот» в 2022 году?

— Перед менеджментом основной задачей остается реализация комплекса антикризисного управления, с учетом непременного сохранения пунктуальности (а мы помним, что «Аэрофлот» лидирует в мировом рейтинге пунктуальности крупнейших авиаперевозчиков), высокого уровня сервиса, а также высококвалифицированного трудового коллектива — для дальнейшего развития.

Этот год мы, скорее всего, как и прошлый, закончим без прибыли, но с результатом существенно лучшим. Наша задача в 2022 году — реализовать все необходимые мероприятия для скорейшего выхода на операционную окупаемость, хотя бы «ноль плюс», но внешних предпосылок к тому, чтобы достичь хороших финансовых результатов, к сожалению, немного.

В 2022 году мы ждем высокую стоимость авиационного керосина, рост аэропортовых расходов. Поэтому мы нацелены на максимально эффективное, точное и гибкое управление, на последовательное улучшение финансового результата.  

— За счет чего планируете достичь «ноль плюс» и добиться того самого максимального финансового результата: понадобится ли госфинансирование, возможно, продажа акций? 

— Мы не планируем дополнительного выпуска акций. Надеюсь, нам не потребуется госфинансирование. Но, опять же, нестабильность рыночной ситуации и рост стоимости топлива могут привести к самым разным последствиям. Сегодня у нас достаточно возможностей, чтобы подстраховаться на случай неблагоприятных ситуаций. Так, мы планируем привлечь госгарантию на следующий год, но это страховочная мера.

— Вы упомянули проблему постоянно растущей стоимости керосина. Совсем недавно «Аэрофлот» решил повысить стоимость топливного сбора на фоне исторически высоких цен. Планируется ли как-то выносить вопрос на более высокий уровень обсуждения и разрешить проблему? 

— Затраты на керосин составляют около 30% стоимости перевозки. Для удержания стоимости авиаперевозки для пассажиров на приемлемом уровне необходимо наличие механизма эффективного контроля цен на авиатопливо. Такие меры государством принимаются. Так, благодаря принятым в 2018 году решениям правительством разработан механизм демпфера — компенсации государством части стоимости топлива в случае резкого роста цены. Тогда, в 2018 году, закладывался уровень цены, которую, как казалось, рынок вряд ли достигнет. Сейчас мы видим, что это произошло.

По сути, политика хеджирования роста стоимости топлива основывается на этом демпфере. Сама механика нас полностью устраивает. При этом снижение уровня отсечения демпфера позволило бы снять лишнюю нагрузку и с авиакомпаний, и, главное, с пассажиров. 

— Одно из самых ожидаемых событий в конце этого года — планируемая сертификация МС-21. Пока процесс не завершен. «Россия» заявляла, что ожидает первый самолет в 2022 году, пока нет информации от производителя о сдвигах срока поставок? 

— Мы готовы принять четыре МС-21 в 2022 году в запланированные сроки и очень ждем эту машину.

— Согласно стратегии «Аэрофлота», именно «Россия» из трех авиакомпаний группы должна стать основным эксплуатантом российских самолетов: как идет процесс передачи самолетов SSJ 100 в парк «России»? 

— Передача Superjet 100 в парк «России», а также получение новых самолетов с завода происходит в соответствии с утвержденным графиком. Все Superjet 100 должны перейти из «Аэрофлота» в парк «России» до августа 2022 года. К концу 2021 года в парке авиакомпании «Россия» будет 66 Superjet 100. К концу 2022 года их количество достигнет 87. В конце следующего года доля самолетов отечественного производства, включая четыре самолета МС-21, в парке «России» составит 66%.

— На фоне проблем с остановкой полетов Boeing 737 Max по всему миру лоукостер «Победа» привлек флот из «Аэрофлота» и «России». Создало ли это нехватку среднемагистральных самолетов в авиакомпаниях, планирует ли группа как-то решать эту задачу? 

— Действительно, на ближайшие два года поставки в «Победу» закрыты за счет перераспределения флота в рамках стратегии группы. Сейчас в эксплуатации «Аэрофлота» остается 37 воздушных судов, которые планируются к передаче в «Победу». В 2022 году мы передадим лоукостеру 20 самолетов Boeing 737.

Дефицита среднемагистральных самолетов в группе нет. Дефицита нет в целом на авиационном рынке, можно даже говорить скорее о профиците.

— В самый пик пандемии «Аэрофлот», как и другие компании, договаривался о переносе лизинговых платежей. Все ли перенесенные платежи уже погашены?

— Около половины суммы перенесенных платежей уже выплачено в период с конца 2020 по сентябрь 2021 года. Остаток реструктурирован и планируется к выплате на 2022–2024 годы. С отдельными лизингодателями пока продолжаются переговоры. На сегодняшний день более подробную информацию давать не могу. Хочу лишь еще раз поблагодарить наших партнеров, которые с пониманием относятся к сложившейся в отрасли ситуации.

Беседовала Мария Амирджанян

МОСКВА, ТАСС

Оригинал

вех в разработке и внедрении датчиков внутриклеточных сигналов на основе FRET: биологическая перспектива истории FRET

https://doi.org/10.1016/j.cellsig.2020.109769Получить права и контент

Основные моменты

История FRET

Измерения внутриклеточных сигналов на основе FRET

Локализованные сигнальные домены цАМФ

Внутрижизненная визуализация FRET

000

передача (FRET) описывается более века. FRET стал основой для изучения локализации белков в живых клетках и тканях. Он также стал широко использоваться в областях, связанных с сотовой сигнализацией. Зонды на основе FRET были разработаны для мониторинга сигналов вторичного мессенджера, состояния фосфорилирования пептидов и белков и последующих клеточных ответов. Здесь мы обсуждаем вехи, которые привели к тому, что FRET стал широко используемым инструментом для изучения биологических систем: теоретическое описание FRET, понимание использования FRET в качестве молекулярного правителя, а также выделение и генетическая модификация зеленого флуоресцентного белка (GFP). ).Каждая из этих вех имела решающее значение для разработки множества зондов и репортеров на основе FRET, которые сегодня широко используются. FRET-зонды предлагают уникальную возможность исследовать сигналы вторичных мессенджеров и последующее фосфорилирование белков — и, возможно, самый эффективный подход для изучения путей цАМФ / PKA. Таким образом, зонды FRET широко используются при изучении внутриклеточных сигнальных путей. Тем не менее, каким-то образом потенциал зондов на основе FRET по созданию окон, через которые мы можем визуализировать сложные клеточные сигнальные системы, не был полностью реализован.В заключение мы обсудим технические проблемы, которые необходимо преодолеть, чтобы зонды на основе FRET соответствовали своему потенциалу для исследования сложных сигнальных сетей.

Ключевые слова

Ферстеровский резонансный перенос энергии

FRET

Флуоресцентные белки

Сигнал вторичного мессенджера

cAMP

cGMP

Кальций

Фосфорилирование статей

2020 Опубликовано Elsevier Inc.

Рекомендуемые статьи

Ссылки на статьи

Последние достижения в области биосенсоров на основе FRET для биомедицинских приложений

https://doi.org/10.1016/j.ab.2021.114323Получить права и контент

Основные моменты

Это В обзоре обсуждается принцип FRET при разработке новых биосенсоров для биомедицинских приложений.

Мы подчеркнули важную роль биосенсоров FRET в предоставлении новых аналитических инструментов для биомедицинских подходов.

Освещены последние достижения и практическое применение биосенсоров FRET.

Акцентируется внимание на текущих проблемах и перспективах использования биосенсоров на основе FRET.

Реферат

Биосенсоры на основе флуоресцентного резонансного переноса энергии (FRET) — эффективные аналитические инструменты, широко используемые в областях биомедицины, фармакологии, токсикологии и пищевых наук. С помощью этих биосенсоров широко выполняется ратиометрическая визуализация основных клеточных процессов, молекулярных компонентов и биологических взаимодействий.Различные биосенсоры на основе FRET предоставили исчерпывающее представление о механизмах, лежащих в основе патологических состояний в живых клетках, тканях и организмах. Более того, интеграция биосенсоров на основе FRET с современными биоаналитическими методами позволяет проводить точную, быструю и чувствительную диагностику и предлагает передовые стратегии лечения. Точный анализ взаимодействий лиганд-рецептор с помощью биосенсоров на основе FRET представляет собой основу для определения новых терапевтических агентов.Таким образом, это исследование было разработано для обзора последних разработок в области биосенсоров на основе FRET и их биомедицинских приложений. Кроме того, обсуждались характеристики, проблемы и перспективы этих биосенсоров.

Ключевые слова

Биомедицинское приложение

Биосенсор

Биомаркер рака

Клеточная визуализация

FRET

Ратиометрическая визуализация

Рекомендуемые статьи Цитирующие статьи (0)

Inc. Просмотреть полный текст

© 2021Все права защищены.

Рекомендуемые статьи

Цитирующие статьи

Доноры и акцепторы: новые разработки во FRET | Сентябрь 2009 г.


Перенос энергии резонанса Фёрстера, или FRET, внес свой вклад в развитие множества приложений. Измерение передачи энергии между донорными и акцепторными красителями, прикрепленными к двум концам молекулы или к двум разным молекулам, сближенным, позволяет исследователям исследовать ряд биологических процессов, включая взаимодействия белок-белок и белок-ДНК, связывание лиганд-рецептор и конформационные изменения белка в ответ на биологический стимул. Это также позволяет им исследовать пространственные отношения в биологических структурах и макромолекулах, отслеживая расстояние между двумя сайтами, меченными флуорофором.

FRET-микроскопия оказалась популярным средством характеристики молекулярных взаимодействий в живых организмах. Кроме того, эта способность к межмолекулярному зондированию облегчает выполнение множества биоаналитических и биосенсорных приложений.


Исследователи сообщили о методе FRET, в котором используются многослойные наночастицы ядро-оболочка для использования явления, известного как усиленная металлом флуоресценция.Здесь показано схематическое изображение усиленного металлом FRET в наночастицах. Серебряное ядро ​​окружено концентрическими слоями молекул флуорофора, а расстояние между ними точно регулируется путем добавления спейсерной оболочки из диоксида кремния контролируемой толщины. Взаимодействие ядра с молекулами флуорофора увеличивает расстояние, на котором происходит FRET, и значительно усиливается интенсивность флуоресценции.

Разработка техники продолжается. В последние годы FRET извлек выгоду из множества новых компонентов и методологий.Улучшения стали возможными, сказал Сапна К. Део, доцент кафедры биоаналитической химии Университета Индианы и Университета Пердью в Индианаполисе, благодаря доступности недорогих мощных лазеров и детекторов, таких как лавинные фотодиоды и фотонные умножители, благодаря развитию флуоресцентной микроскопии. а также за счет разработки лучших фильтров, лучшего программного обеспечения для анализа данных и лучших камер.

По ее словам, использование новых доноров и акцепторов добавило дополнительных преимуществ в его разработку.Обычные флуорофоры, используемые с FRET, включая органические красители, флуоресцентные белки, хемилюминесцентные субстраты и флуоресцентные полимеры, часто имеют ограниченные возможности. Их узкие окна возбуждения и широкие излучения могут привести к спектральному перекрытию между донором и акцептором, например, что может вызвать головную боль, особенно при мониторинге взаимодействий между двумя или более парами донор-акцептор с мультиплексированным FRET. Другие проблемы — ограниченная фотостабильность и возможность фотообесцвечивания и фотодеградации.Исследователи изучили несколько альтернатив, чтобы обойти эти проблемы. В последние годы появились металлические наночастицы и биолюминесценция для улучшения FRET. Каждый из них предлагает уникальный набор преимуществ по сравнению с обычными флуорофорами и, таким образом, может улучшить методику для широкого спектра приложений.

Флюоресценция с усилением металлов
В Квебеке исследователи добились улучшения FRET с помощью многослойных наночастиц ядро-оболочка, чтобы воспользоваться преимуществом явления, известного как флуоресценция с усилением металлов.Размещение донорно-акцепторных пар вокруг металлических наночастиц или рядом с ними приводит к взаимодействию между локальным электрическим полем от источника возбуждения, электронами в металле и электрическим диполем, индуцированным в молекулах красителя, увеличивая силу донорно-акцепторных взаимодействий и, таким образом, улучшая Эффективность FRET.

Дени Будро, профессор аналитической химии и член Центра оптики, фотоники и лазеров Университета Лаваля в Квебеке, понял, что эффективность этого подхода сильно зависит от разделения металла и флуорофора, и поэтому исследователи может максимально увеличить его, получая точный контроль над этим расстоянием.С этой целью в статье Nano Letters, опубликованной в Интернете 15 июля, он и другие сотрудники его лаборатории — докторант Матье Лессар-Вигер при поддержке аспирантов Максима Риу и Люка Рейнвилля — сообщили об исследовании, в котором они изготовили наночастицы типа ядро-оболочка. и химически привитые молекулы флуорофора в концентрических оболочках из диоксида кремния, чтобы они могли произвольно регулировать расстояние между флуорофором и металлом для оптимизации усиления FRET.

Эти новые люминесцентные наночастицы имеют два важных преимущества, сказал Будро.Во-первых, они приводят к значительному увеличению интенсивности флуоресценции. Исследователи сообщили о пятнадцатикратном увеличении количества частиц, используемых в исследовании Nano Letters, и ожидают еще большего увеличения при использовании более тонких разделительных оболочек в своей конструкции. Что еще более важно, использование наночастиц привело к значительному увеличению FRET.

Будро и его коллеги рассчитали, что эффективность передачи энергии между донором и акцептором составляет 56 процентов, в отличие от эффективности только 12 процентов для наночастиц, у которых металлическая сердцевина была вытравлена.Кроме того, они отметили, что расстояние Ферстера — диапазон, при котором эффективность передачи энергии составляет 50 процентов — было на 30 процентов выше, чем опубликованное для системы флуоресцеин-эозин.

Это увеличение расстояния Ферстера позволяет рекомендовать наночастицы для различных применений в визуализирующей микроскопии и биодатчиках, пояснил Будро; например, путем конъюгирования их с биомолекулами и использования в качестве донорно-акцепторных пар дальнего действия.

Исследователи продолжают разрабатывать наночастицы, ориентируясь на эти и другие приложения, включая сверхчувствительное обнаружение ДНК.Они также планируют адаптировать их к мультиплексной передаче сигналов, варьируя их красители и относительные концентрации, а также настраивая сигнатуры излучения.

Биолюминесцентный резонансный перенос энергии
Биолюминесцентный резонансный перенос энергии, или BRET, представляет собой еще один важный шаг вперед в этой области. Этот метод, в котором используются биолюминесцентный донор и флуоресцентный акцептор, преодолевает многие препятствия, связанные с методами на основе FRET. Во-первых, поскольку он не требует внешнего источника возбуждения, как последние методы, он менее дорог и обеспечивает повышенную эффективность для приложений in vivo.Кроме того, он не имеет тех же проблем, что и FRET, с фотообесцвечиванием и одновременным возбуждением донорных и акцепторных флуорофоров и, как следствие, предлагает значительно сниженный фоновый шум. Наконец, он более совместим с светочувствительными тканями, чем методы на основе FRET.


Ученые описали метод биолюминесцентного резонансного переноса энергии, в котором люцифераза Renilla используется в качестве биолюминесцентного донора, а квантовые точки — в качестве акцепторов. В описанной системе используются два зонда: один, конъюгированный с люциферазой Renilla и комплементарный целевой последовательности (зонд Rluc на этом рисунке), другой, конъюгированный с квантовой точкой и гомологичный целевой последовательности (целевой зонд).Когда нуклеиновая кислота-мишень отсутствует, два зонда гибридизуются, приближая люциферазу и квантовую точку друг к другу и, таким образом, производя сигнал BRET.

Лаборатория Део занимается разработкой основанных на BRET методов количественного определения микроРНК. По ее словам, микроРНК играют важную роль в регуляции генов и, таким образом, привлекают внимание как клинически как биомаркеры заболеваний, так и в фундаментальных биомедицинских исследованиях. Исследователи в лаборатории разработали методику на основе BRET, в которой люцифераза Renilla используется в качестве биолюминесцентного донора и квантовые точки в качестве акцепторов, и они описали ее использование для обнаружения ДНК.Сообщаемая система BRET использует два линейных олигонуклеотидных зонда. Первый, конъюгированный с люциферазой Renilla, комплементарен целевой последовательности. Другой, конъюгированный с квантовой точкой, гомологичен целевой последовательности. Два зонда гибридизуются, когда нуклеиновая кислота-мишень отсутствует, сближая люциферазу и квантовую точку и создавая сигнал BRET.

Однако, когда целевая нуклеиновая кислота присутствует, она конкурирует с зондом люциферазы за гибридизацию зонда квантовой точки.Это приводит к снижению сигнала BRET и увеличению эмиссии люциферазы, что позволяет исследователям измерять нуклеиновую кислоту.

Для количественного определения ДНК исследователи построили калибровочную кривую отношения BRET в зависимости от целевой концентрации. Они рассчитали отношение BRET как интенсивность биолюминесценции при 485 нм, деленную на интенсивность биолюминесценции при 705 нм. Основываясь на полученном соотношении, они количественно определили количество ДНК-мишени по уравнению калибровочной кривой.

Исследователи продолжают развивать методику и работают над мультиплексным обнаружением нуклеиновых кислот-мишеней в фазе раствора. Это может быть достигнуто с помощью нескольких спектрально различных квантовых точек. Из-за их перекрывающихся спектров поглощения несколько квантовых точек можно возбуждать одновременно с помощью одного источника, такого как люцифераза Renilla.

«Таким образом, — сказал Део, — используя люциферазу Renilla в качестве доноров BRET и несколько квантовых точек в качестве акцепторов BRET, можно достичь мультиплексного обнаружения.Последовательности ДНК олигонуклеотидных зондов необходимо изменить только для специфической гибридизации с их соответствующими мишенями ».

См. Также: Дополнительные веб-сайты


Разработка индикаторов на основе FRET для визуализации гомофильного транс-взаимодействия кластерного протокадгерина

  • 1.

    Кохмура, Н. и др. Разнообразие, обнаруженное новым семейством кадгеринов, экспрессируемых в нейронах синаптического комплекса Neuron 20 , 1137–1151.https://doi.org/10.1016/s0896-6273(00)80495-x (1998).

    CAS Статья PubMed Google Scholar

  • 2.

    Wu, Q. & Maniatis, T. Поразительная организация большого семейства генов адгезии человеческих нейронных кадгерин-подобных клеток. Ячейка 97 , 779–790. https://doi.org/10.1016/s0092-8674(00)80789-8 (1999).

    CAS Статья PubMed Google Scholar

  • 3.

    Esumi, S. et al. Моноаллельная, но комбинаторная экспрессия вариабельных экзонов кластера генов протокадгерина-α в отдельных нейронах. Нат. Genet. 37 , 171–176. https://doi.org/10.1038/ng1500 (2005).

    CAS Статья PubMed Google Scholar

  • 4.

    Kaneko, R. et al. Аллельная генная регуляция кластеров Pcdh-α и Pcdh-γ , включающая как моноаллельную, так и двуаллельную экспрессию в отдельных клетках Пуркинье. J. Biol. Chem. 281 , 30551–30560. https://doi.org/10.1074/jbc.M605677200 (2006).

    CAS Статья PubMed Google Scholar

  • 5.

    Hirano, K. et al. Разнообразие одиночных нейронов, генерируемое кластером протокадгерина-β в центральной и периферической нервной системе мышей. Фронт. Мол. Neurosci. 5 , 90. https://doi.org/10.3389/fnmol.2012.00090 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 6.

    Schreiner, D. & Weiner, J. A. Комбинаторное гомофильное взаимодействие между мультимерами гамма-протокадгерина значительно увеличивает молекулярное разнообразие клеточной адгезии. Proc. Natl. Акад. Sci. США 107 , 14893–14898. https://doi.org/10.1073/pnas.1004526107 (2010).

    ADS Статья PubMed PubMed Central Google Scholar

  • 7.

    Thu, C. A. et al. Одноклеточная идентичность, генерируемая комбинаторными гомофильными взаимодействиями между протоколами α, β и γ. Ячейка 158 , 1045–1059. https://doi.org/10.1016/j.cell.2014.07.012 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 8.

    Рубинштейн, Р., Гудман, К. М., Маниатис, Т., Шапиро, Л. и Хониг, Б. Структурное происхождение кластерного протокадгерин-опосредованного нейронного штрих-кодирования. Семин. Cell Dev. Биол. 69 , 140–150. https://doi.org/10.1016/j.semcdb.2017.07.023 (2017).

    CAS Статья PubMed PubMed Central Google Scholar

  • 9.

    Mountoufaris, G., Canzio, D., Nwakeze, C. L., Chen, W. V. и Maniatis, T. Написание, чтение и перевод кластерного кода распознавания поверхности клеток протокадгерина для сборки нейронной цепи. Annu. Rev. Cell Dev. Биол. 34 , 471–493. https://doi.org/10.1146/annurev-cellbio-100616-060701 (2018).

    CAS Статья PubMed Google Scholar

  • 10.

    Панчо А., Аэртс Т., Мицогианнис М. Д. и Сунтьенс Е. Протокадгерины на перекрестке сигнальных путей. Фронт. Мол. Neurosci. 13 , 117. https://doi.org/10.3389/fnmol.2020.00117 (2020).

    CAS Статья PubMed PubMed Central Google Scholar

  • 11.

    Лефевр, Дж. Л., Костадинов, Д., Чен, В. В., Маниатис, Т. и Санес, Дж. Р. Протокадгерины опосредуют дендритное самопознание в нервной системе млекопитающих. Природа 488 , 517–521. https://doi.org/10.1038/nature11305 (2012).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 12.

    Костадинов Д. и Санес Дж. Р. Протокадгерин-зависимое самопроизвольное избегание дендритов регулирует нейронные связи и функцию контуров. Элиф 4 , e08964. https://doi.org/10.7554/eLife.08964 (2015).

    Артикул PubMed Central Google Scholar

  • 13.

    Ing-Esteves, S. et al. Комбинаторные эффекты альфа- и гамма-протокадгеринов на выживаемость нейронов и самопроизвольное избегание дендритов. J. Neurosci. 38 , 2713–2729. https://doi.org/10.1523/JNEUROSCI.3035-17.2018 (2018).

    CAS Статья PubMed PubMed Central Google Scholar

  • 14.

    Hasegawa, S. et al. Семейство протокадгеринов-α участвует в слиянии аксонов обонятельных сенсорных нейронов в клубочки обонятельной луковицы у мышей. Мол. Клетка. Neurosci. 38 , 66–79. https://doi.org/10.1016/j.mcn.2008.01.016 (2008).

    CAS Статья PubMed Google Scholar

  • 15.

    Mountoufaris, G. et al. Разнообразие Multicluster Pcdh необходимо для сборки обонятельной нейронной цепи мыши. Наука 356 , 411–414. https://doi.org/10.1126/science.aai8801 (2017).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 16.

    Katori, S. et al. Семейство протокадгеринов-α необходимо для серотонинергических проекций, чтобы должным образом иннервировать целевые области мозга. J. Neurosci. 29 , 9137–9147. https://doi.org/10.1523/JNEUROSCI.5478-08.2009 (2009 г.).

    CAS Статья PubMed PubMed Central Google Scholar

  • 17.

    Katori, S. et al. Протокадгерин-αC2 необходим для диффузных проекций серотонинергических аксонов. Sci. Реп. 7 , 15908. https://doi.org/10.1038/s41598-017-16120-y (2017).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 18.

    Chen, W. V. et al. PcdhαC2 необходим для облицовки аксонов и сборки серотонинергических цепей у мышей. Наука 356 , 406–411. https://doi.org/10.1126/science.aal3231 (2017).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 19.

    Гарретт А.М., Шрейнер Д., Лобас М.А. и Вайнер Дж. А. γ-Протокадгерины контролируют дендритов кортикального слоя, регулируя активность сигнального пути FAK / PKC / MARCKS. Нейрон 74 , 269–276. https://doi.org/10.1016/j.neuron.2012.01.028 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 20.

    Suo, L., Lu, H., Ying, G., Capecchi, M. R. & Wu, Q. Кластеры протокадгерина и киназа клеточной адгезии регулируют сложность дендритов через Rho GTPase. J. Mol. Cell Biol. 4 , 362–376. https://doi.org/10.1093/jmcb/mjs034 (2012 г.).

    CAS Статья PubMed Google Scholar

  • 21.

    Молумби, М. Дж., Киллер, А. Б. и Вайнер, Дж. А. Гомофильные межклеточные взаимодействия протокадгерина способствуют усложнению дендритов. Cell Rep. 15 , 1037–1050. https://doi.org/10.1016/j.celrep.2016.03.093 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 22.

    Molumby, M. J. et al. γ-Протокадгерины взаимодействуют с нейролигином-1 и негативно регулируют морфогенез дендритного шипа. Cell Rep. 18 , 2702–2714. https://doi.org/10.1016/j.celrep.2017.02.060 (2017).

    CAS Статья PubMed PubMed Central Google Scholar

  • 23.

    Steffen, D. M. et al. γ-Протокадгерины физически и функционально взаимодействуют с нейролигином-2, чтобы негативно регулировать тормозную плотность синапсов и они необходимы для нормального социального взаимодействия. Мол. Neurobiol. 58 , 2574–2589. https://doi.org/10.1007/s12035-020-02263-z (2021 г.).

    CAS Статья PubMed Google Scholar

  • 24.

    Reiss, K. et al. Регулируемое ADAM10-зависимое отщепление эктодомена гамма-протокадгерина C3 модулирует клеточную адгезию. J. Biol. Chem. 281 , 21735–21744. https://doi. org/10.1074/jbc.M602663200 (2006).

    CAS Статья PubMed Google Scholar

  • 25.

    Rubinstein, R. et al. Молекулярная логика самопознания нейронов через взаимодействия протокадгериновых доменов. Ячейка 163 , 629–642. https://doi.org/10.1016/j.cell.2015.09.026 (2015).

    CAS Статья PubMed PubMed Central Google Scholar

  • 26.

    Goodman, K. M. et al. Структурная основа разнообразного гомофильного распознавания кластеризованными α- и β-протокадгеринами. Нейрон 90 , 709–723. https://doi.org/10.1016/j.neuron.2016.04.004 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 27.

    Goodman, K. M. et al. γ-Протокадгерин структурное разнообразие и функциональные последствия. Элиф 5 , e20930. https://doi. org/10.7554/eLife.20930 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 28.

    Goodman, K. M. et al. Protocadherin cis -димерная архитектура и разнообразие единиц распознавания. Proc. Natl. Акад. Sci. США 114 , E9829 – E9837. https://doi.org/10.1073/pnas.1713449114 (2017).

    CAS Статья PubMed PubMed Central Google Scholar

  • 29.

    Ozawa, M. & Kemler, R. Изменение активности клеточной адгезии перванадатом из-за диссоциации α-катенина от комплекса E-cadherin catenin. J. Biol. Chem. 273 , 6166–6170. https://doi.org/10.1074/jbc.273.11.6166 (1998).

    CAS Статья PubMed Google Scholar

  • 30.

    Страйер, Л. и Хогланд, Р. П. Передача энергии: спектроскопическая линейка. Proc. Natl. Акад. Sci. США 58 , 719–726. https://doi.org/10.1073/pnas.58.2.719 (1967).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 31.

    Greenwald, E.C., Mehta, S. & Zhang, J. Генетически закодированные флуоресцентные биосенсоры освещают пространственно-временную регуляцию сигнальных сетей. Chem. Ред. 118 , 11707–11794. https://doi.org/10.1021/acs.chemrev.8b00333 (2018).

    CAS Статья PubMed PubMed Central Google Scholar

  • 32.

    Ким, С. А., Тай, С. Ю., Мок, Л. П., Моссер, Э. А. и Шуман, Э. М. Кальций-зависимая динамика взаимодействий кадгерина в межклеточных соединениях. Proc. Natl. Акад. Sci. США 108 , 9857–9862. https://doi.org/10.1073/pnas.10108 (2011 г.).

    ADS Статья PubMed PubMed Central Google Scholar

  • 33.

    Fernàndez-Monreal, M., Kang, S. & Phillips, G. R. Гомофильное взаимодействие гамма-протокадгерина и внутриклеточный трафик контролируется цитоплазматическим доменом в нейронах. Мол. Клетка. Neurosci. 40 , 344–353.https://doi.org/10.1016/j.mcn.2008.12.002 (2009).

    CAS Статья PubMed Google Scholar

  • 34.

    Feinberg, E.H. et al. Восстановление GFP через синаптические партнеры (GRASP) определяет клеточные контакты и синапсы в живых нервных системах. Нейрон 57 , 353–363. https://doi.org/10.1016/j.neuron.2007.11.030 (2008).

    CAS Статья PubMed Google Scholar

  • 35.

    Kim, J. et al. mGRASP позволяет картировать синаптические связи млекопитающих с помощью световой микроскопии. Нат. Методы 9 , 96–102. https://doi.org/10.1038/nmeth.1784 (2011 г.).

    CAS Статья PubMed PubMed Central Google Scholar

  • 36.

    Tsetsenis, T., Boucard, A. A., Araç, D., Brunger, A. T. & Südhof, T. C. Прямая визуализация транс-синаптических взаимодействий нейрексин-нейролигин во время образования синапсов. J. Neurosci. 34 , 15083–15096. https://doi.org/10.1523/JNEUROSCI.0348-14.2014 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 37.

    Choi, J.H. et al. Межрегиональные синаптические карты среди клеток инграммы лежат в основе формирования памяти. Наука 360 , 430–435. https://doi.org/10.1126/science.aas9204 (2018).

    ADS CAS Статья PubMed Google Scholar

  • 38.

    Kinoshita, N. et al. Генетически закодированный флуоресцентный индикатор GRAPHIC очерчивает межклеточные связи. Наука 15 , 28–38. https://doi.org/10.1016/j.isci.2019.04.013 (2019).

    CAS Статья Google Scholar

  • 39.

    Киношита, Н., Хуанг, А. Дж. Й., МакХью, Т. Дж., Мияваки, А. и Шимогори, Т. Диффузионная ГРАФИКА для визуализации морфологии клеток после специфического межклеточного контакта. Sci. Реп. 10 , 14437. https://doi.org/10.1038/s41598-020-71474-0 (2020).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 40.

    Hasegawa, S. et al. Кластерные протокадгерины необходимы для построения функциональных нейронных цепей. Фронт. Мол. Neurosci. 10 , 114. https://doi.org/10.3389/fnmol.2017.00114 (2017).

    CAS Статья PubMed PubMed Central Google Scholar

  • 41.

    Fujii, Y. et al. Тег PA: универсальная система маркировки белков с использованием антитела со сверхвысокой аффинностью против додекапептида, полученного из подопланина человека. Protein Expr. Purif. 95 , 240–247. https://doi. org/10.1016/j.pep.2014.01.009 (2014).

    CAS Статья PubMed Google Scholar

  • 42.

    Shibata, H. et al. Новая роль аннексина A11 в раннем секреторном пути посредством стабилизации белка Sec31A в сайтах выхода эндоплазматического ретикулума (ERES). J. Biol. Chem. 290 , 4981–4993. https://doi.org/10.1074/jbc.M114.592089 (2015).

    CAS Статья PubMed Google Scholar

  • 43.

    Kanadome, T., Shibata, H., Kuwata, K., Takahara, T. & Maki, M. Кальций-связывающий белок ALG-2 способствует локализации места выхода эндоплазматического ретикулума и полимеризации Trk-слитого ген (TFG) белок. FEBS J. 284 , 56–76. https: // doi.org / 10.1111 / febs.13949 (2017).

    CAS Статья PubMed Google Scholar

  • Разработка генетически кодируемой системы FRET с использованием флуоресцентных РНК-аптамеров

    YO3-ацетатный синтез

    Et 3 N (0,26 мл, 1,86 ммоль, 1 экв. ) Добавляли к перемешиваемому раствору 4 — [( E ) -2- (ацетилфениламино) этенил] -1-метилхинолинииодид 28 (790 мг, 1,84 ммоль, 1 экв.) И 2- (2-метилбенз [ d ] оксазол-3-иум-3-ил) ацетат 42 (500 мг, 2.62 ммоль, 1,42 экв.) В DCM. Раствор оставляли перемешиваться на 20 ч с последующим концентрированием в вакууме. Затем твердое вещество ресуспендировали в DCM (150 мл), фильтровали и промывали ацетоном (3 × 10 мл). Твердое вещество сушили в вакууме с получением (85 мг, 12%) YO3-ацетата в виде аморфного твердого вещества пурпурного цвета. 1 H ЯМР (400 МГц, ДМСО- D6 ) δ 10,17 (с, 1H), 8,47-8,38 (м, 2H), 8,34-8,28 (м, 1H), 8,24-8,18 (м, 1H), 8,18–8,13 (м, 1H), 7,94–7,87 (м, 2H), 7,68–7,59 (м, 3H), 7,52–7,46 (м, 1H), 7,41–7,28 (м, 3H), 7.01–6,94 (м, 1H), 5,91–5,82 (м, 1H), 4,47 (с, 2H), 4,05 (с, 3H). HRMS (ESI) [M + , C 22 H 19 N 2 O 3 + ] требует м / z 359,1390, найдено 359,1395.

    YO3 PEG 3-звенный синтез биотина амина

    HBTU (45 мг, 3 экв.) И DIPEA (30 экв.) Добавляли к YO3-ацетату (3 мг, 1 экв.) В ДМФ (250 мкл). Раствору давали возможность перемешиваться в течение 10 минут, после чего добавляли N -биотинил-3,6,9-триоксаундекан-1,11-диамин 43 (7 мг, 2 экв.) И раствор перемешивали в течение 18 часов. .Растворитель лиофилизировали и остаток повторно растворяли в 1: 1 MeCN / 50 мМ NH 4 OAc (водн.) . Затем раствор очищали с помощью ОФ-ВЭЖХ (25–50% MeCN против 50 мМ NH 4 OAc за 30 мин). RP-HPLC Rt = 14,9 мин. HRMS (ESI) [M + , C 40 H 51 N 6 O 7 S + ] требует м / z 759,3534, найдено 759,3531.

    Структурное моделирование РНК

    Трехмерный (3D) дизайн базовой структуры оригами 2H-AE РНК был подробно описан ранее 24, 44 .Вкратце, с помощью программ 3D-моделирования Swiss-PdbViewer 45 и UCSF Chimera 46 две стандартные двойные спирали РНК А-формы были выровнены параллельно и повернуты, чтобы создать оптимальное расстояние для антипараллельного равномерного (AE) двойного кроссовера (DX). ). Внутренняя 180 ° целующаяся петля (HIV-1 DIS, PDB id: 2B8R) была расположена между кроссоверами, а тетрапетли UUCG (извлеченные из PDB id: 1F7Y) были расположены на концах двойных спиралей. Трехмерный дизайн конструкций apta-FRET был основан на структуре оригами 2H-AE РНК.Минимальное ядро ​​аптамера шпината (PDB id: 4Q9R), ранее использовавшееся для создания Bunch of Baby Spinach 47 , было расположено на одном из внешних доменов двойной спирали, фланкирующих DX. Мотив шпината был повернут так, чтобы направить дипольный момент DFHBI-1T либо непосредственно в сторону, либо от соседнего параллельного домена двойной спирали, где должен был располагаться аптамер манго. Ядро исходного аптамера шпината фланкируется двумя доменами с двойной спиралью, названными Хуангом и др. P1.2 и P2.1. 31 Это позволяет использовать две разные версии включения; «нормальная» версия, в которой домен P1.2 использовался для соединения шпината с РНК-оригами, и «перевернутая» версия (помеченная *), где домен P2. 1 использовался для соединения шпината с РНК-оригами. Стебель-петля, построенная из стандартной двойной спирали А-формы и тетрапетли UUCG, была прикреплена к другому концу ядра шпината. Из-за стерических столкновений только две из четырех возможных версий оказались жизнеспособными; нормальная версия с диполем, направленным в сторону соседней двойной спирали, и перевернутая версия с диполем, направленным в сторону от соседней двойной спирали.Недавно опубликованная сокристаллическая структура аптамера манго выявила трехуровневый G-квадруплекс, связанный с доменом двойной спирали через тетрапетлевый мотив GAAA, и не позволяет манго «переворачивать», как шпинат. Связь между тетрапетлей и G-квадруплексом структурно не определена и, как ожидается, будет гибкой, а TO3-биотин (очень похож на YO3-биотин) не может быть смоделирован в связывающем кармане без стерических столкновений. Следовательно, мы не смогли смоделировать точное положение диполя флуорофора YO3-биотина.Чтобы найти оптимальное положение Mango, длина домена двойной спирали между Mango и ближайшим DX изменялась с шагом в две пары оснований. На некоторых позициях были стерические столкновения. После начального моделирования 3D-структуры были лигированы с помощью Perl-скрипта («ligate.pl», который доступен на нашей веб-странице www.andersen-lab.dk) и уточнены с помощью функции рекурсивного геометрического уточнения в Assemble2 48 . 3D-модели в этой работе были визуализированы в UCSF Chimera.

    Расчет дипольного момента

    Дипольный момент DFHBI-1T был рассчитан с использованием пакета программ Marvin (версия 15.10.19) и плагин Calculator, разработанный ChemAxon (http://www.chemaxon.com/). Химическая структура DFHBI-1T была нарисована в MarvinSketch, а состояние протонирования молекулы было определено при pH 7,8 с использованием подключаемого модуля pKa Calculator. Дипольный момент наиболее распространенных микровидов DFHBI-1T (70,4% при pH 7,8) был рассчитан с использованием подключаемого модуля Dipole Moment Calculator. Полный дипольный момент DFHBI-1T был визуализирован как вектор, выраженный в системе координат главной оси. Полученный файл, показывающий как химическую структуру, так и вектор дипольного момента DFHBI-1T, был экспортирован как файл pdb и импортирован в Swiss-PdbViewer 45 для выравнивания молекулы флуорофора с трехмерными координатами DFHBI из кристаллической структуры шпината (PDB id : 4Q9R).

    Дизайн последовательности РНК

    Процесс создания последовательности ранее был подробно описан 24, 44 . Вкратце, 3D-модели были загружены в Assemble2 48 для визуализации вторичной структуры, которые были вручную перенесены в текстовые файлы проекта 2D-структуры. Для apta-FRET с разветвленным KL мотив Т-образного соединения был создан в 2D-схеме путем замены двух выпуклых аденинов в одном из партнеров петли поцелуев на петлю-ножку. Последовательность консервативных мотивов РНК (KL, тетрапетли, шпинат, манго, РНК-захватчик) была сохранена, а оставшаяся последовательность была обозначена Ns.Каждая последовательность была дополнительно ограничена путем «блокировки» кроссоверов парами оснований GC, включения пары колебаний GU на каждые восемь непрерывных пар оснований и ограничения 5′-конца до 5′-GGGAGA-3 ‘, оптимальной последовательности инициации для T7. РНК-полимераза. 2D-чертежи были прочитаны сценарием Perl («trace.pl», который доступен на нашей веб-странице www.andersen-lab.dk), который выводит обозначение точечных скобок и ограничения последовательности, подходящие для проектирования последовательности в NUPACK 49 . Последовательности, разработанные в NUPACK, были свернуты и оценены с использованием mFold 50 .

    Синтез ДНК-матриц

    ДНК-матриц конструкций apta-FRET получали с помощью стандартной ПЦР-амплификации фрагментов гена gBlocks из IDT с использованием ДНК-полимеразы высокой точности Phusion (ThermoFischer Scientific). Амплификации выполняли в 1 × буфере Phusion HF (предоставленном производителем), 200 мкМ dNTP (invitrogen), 1 мкМ прямого (Fwd) и обратном (Rev) праймерах (заказанных у IDT), 4 нг gBlock и 1 ед. Полимеразы Phusion. ДНК-матрицы простых аптамеров получали с помощью стандартной ПЦР-амплификации ДНК-ультрамеров (IDT) с использованием ДНК-полимеразы Taq (Invitrogen). Амплификации выполняли в буфере Taq 1 × , 200 мкМ dNTP (invitrogen), 1,5 мМ MgCl 2 , 1 мкМ праймеров Fwd и Rev, 4 нг ультрамера и 2,5 мкМ ДНК-полимеразы Taq U . Праймеры Fwd и Rev были разработаны для каждой матрицы (см. Дополнительное примечание 2), а температуры отжига были рассчитаны с использованием калькулятора New England Biolabs (NEB) T m (http://tmcalculator.neb.com/). Амплифицированную ДНК очищали с использованием набора для очистки ДНК GFX PCR (иллюстрация) и хранили в буфере ТЕ.

    Транскрипция in vitro и очистка РНК

    Транскрипция in vitro выполнялась путем смешивания ДНК-матрицы, транскрипционного буфера (15 мМ Mg (OAc) 2 , 50 мМ трис-ацетат pH 7,8, 40 мМ NaCl, 0,1% Tween20) , 1 мМ DTT и NTP (по 2,5 мМ каждый). Добавляли РНК-полимеразу Т7 (собственного производства), и образцы инкубировали при 37 ° C в течение не менее 4 часов. Реакцию останавливали, добавляя ДНКазу I (ThermoFischer Scientific) до концентрации 1 ед. / 100 мкл и инкубируя при 37 ° C в течение 15 мин.Транскрибируемую РНК очищали на 6% полиакриламидных гелях после смешивания 1: 1 с денатурирующим загрузочным буфером (95% формамид, 18 мМ EDTA, 0,025% SDS, бромфеноловый синий, ксилолцианол) и нагревания до 95 ° C в течение 5 минут. Полосы геля визуализировали с помощью УФ-затенения, вырезали из геля и элюировали в течение ночи свободным от нуклеаз H 2 O (Ambion). Кусочки геля отделяли от жидкости с использованием спин-колонок для гелевой экстракции ДНК Freeze’n’Squeeze (Bio-Rad), и, наконец, РНК осаждали этанолом, ресуспендировали в свободной от нуклеаз H 2 O и хранили при -20 ° C. .

    Тепловой отжиг структур РНК оригами

    Транскрибируемая РНК была подвергнута тепловому отжигу перед использованием для обеспечения правильного сворачивания структур оригами РНК. Сначала РНК в свободной от нуклеаз H 2 O нагревали до 95 ° C в течение 5 минут, а затем быстро охлаждали при -20 ° C в течение 3 минут. Затем добавляли 5-кратный буфер для сборки (5-кратный TB, 625 мМ KCl, 5 мМ MgCl 2 ) до конечной концентрации 1х, и образцы оставляли при 37 ° C на 30 мин.

    Измерения флуоресценции

    Измерения флуоресценции проводили на FluoroMax 4 от Horiba, Jobin Yvon.Возбуждение DFHBI-1T и YO3-биотина проводили при 450 нм и 580 нм соответственно. Эмиссия DFHBI-1T и YO3-биотина регистрировалась при 503 нм и 620 нм соответственно. Щели монохроматора были установлены на 5 нм, а время интегрирования составляло 0,2 с. Измерения проводились на объемах образцов от 65 до 100 мкл, и использовались концентрации флуорофора 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотина, если не указано иное. Относительные значения FRET были рассчитаны с использованием уравнения \ ({\ rm FRET} = \ frac {{I _ {\ rm {DY}} (ex _ {\ rm D}, em _ {\ rm Y})}} {{I _ {\ rm {DY}} (ex _ {\ rm D}, em _ {\ rm Y}) + I _ {\ rm {DY}} (ex _ {\ rm D}, em _ {\ rm D})}} \), где I DY ( ex D , em Y ) — это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T и I DY ( em D ) — излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T. Оба были измерены с присутствием DFHBI-1T и YO3-биотина.

    Анализы связывания флуорофора и конкуренции

    Анализы активации и конкуренции флуорофора проводили на структурах РНК-оригами, содержащих только шпинат или только манго, или с пустой структурой 2H-AE (дополнительное примечание 1). Конструкции были подвергнуты тепловому отжигу перед измерениями в соответствии с описанным выше протоколом. Концентрации как РНК, так и флуорофоров указаны на соответствующих рисунках. Измерения проводили в 1 × сборочном буфере.

    Fluorophore EC

    50 измерения

    Было измерено сродство связывания с различными флуорофорами аптамеров, интегрированных в структуры оригами РНК. Конструкции перед использованием подвергали тепловому отжигу в соответствии с описанным выше протоколом, и образцы готовили в 1-кратном буфере для сборки. Измерения проводились с использованием серийно разведенных флуорофоров в концентрациях от 1 нМ до 2 мкМ. Все образцы готовили в трех экземплярах как с 20 нМ РНК, так и без нее, и флуоресценцию измеряли на VarioSkan Flash Reader (Thermo Scientific) путем возбуждения образцов, содержащих DFHBI-1T или YO3-биотин, при 450 нм или 580 нм, соответственно. Фоновую флуоресценцию от каждой концентрации флуорофора в отсутствие РНК вычитали из записанных интенсивностей перед вычислением ЕС 50 . EC 50 рассчитывали в GraphPad Prism 7.0b для Mac OS X с использованием нелинейного регрессионного анализа «логарифм (агонист) против ответа (три параметра)» кривой доза-ответ.

    Измерения усиления флуоресценции

    Усиление флуоресценции было рассчитано для флуорофоров в минимальной версии аптамеров и для аптамеров, интегрированных в структуры оригами РНК.В целом, 1 мкМ РНК в 1 × буфере для сборки инкубировали со 100 нМ соответствующего флуорофора. Усиление флуоресценции рассчитывалось по формуле \ (F _ {\ rm {E}} = \ frac {{I _ {{\ rm {F}} + {\ rm {R}}}}} {{I _ {\ rm {F }}}} \), где I F + R — интенсивность флуоресценции флуорофора в присутствии РНК, а I F — интенсивность флуоресценции одного флуорофора (флуоресценция в выключенном состоянии).

    Конформационные изменения в системе apta-FRET

    Визуализация конформационных изменений в качестве ответа на РНК захватчиков выполнялась с помощью измерений с временным разрешением системы apta-FRET, содержащей разветвленный KL. Флуоресценцию как DFHBI-1T, так и YO3-биотина регистрировали каждые 30 с, а между измерениями заслонки закрывали, чтобы избежать обесцвечивания. Обратимая инвазия была получена путем добавления сначала РНК-захватчика с фиксатором до конечной концентрации 200 нМ к смеси 100 нМ структуры apta-FRET, 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотина с последующим добавлением «анти-захватчика». ”До конечной концентрации 400 нМ. Выходы FRET рассчитывались, как описано ранее.

    Захватчик 1: UAGCUUAUCAGACUGAUGUUGAUAUAAAAG;

    Анти-захватчик 1: CUUUUAUAUCAACAUCAGUCUGAUAAGCUA.

    Захватчик 2: CUAGACUGAAGCUCCUUGAGGGAAGUUAG;

    Anti-invader 2: CUAACUUCCCUCAAGGAG CUUCAGUCUAG.

    EC

    50 измерения SAM в датчике apta-FRET SAM

    Сродство связывания SAM в датчике S6-M19-SAM было выполнено путем инкубации с серийно разведенным SAM в концентрациях от 1 мкМ до 2,5 мМ. Измерения проводили в трех повторностях с 50 нМ РНК в буфере для сборки, содержащем 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотин. Измерения проводились в VarioSkan Flash Reader путем возбуждения образцов при 450 нм и регистрации спектров флуоресценции от 470 до 700 нм.Выходы FRET и EC 50 рассчитывались, как описано ранее.

    Процедура клонирования конструкций apta-FRET

    Были выполнены стандартные этапы молекулярного клонирования. Во-первых, амплификацию и кодирование сайтов ограничения ( Bgl II и Eco RI) на концах матриц ДНК проводили с помощью ПЦР-амплификации с использованием ДНК-полимеразы Phusion, как описано выше (см. Дополнительное примечание 2 для последовательностей праймеров). После переваривания с использованием Bgl II и Eco RI (ThermoFischer Scientific — Fastdigest) в течение 30 минут при 37 ° C ДНК очищали с использованием набора для очистки GFX PCR (иллюстрация).pET28c-F30–2xdBroccoli был получен в подарок от Samie Jaffrey (плазмида Addgene № 66843). Плазмиду, полученную в компании на основе плазмиды pET28c, расщепляли с помощью Bgl II и EcoR I и очищали на 1% агарозном геле 0,5 × TBE. Линеаризованную плазмиду pET28c экстрагировали из геля с использованием набора для экстракции геля GFX (иллюстрация), и вставку лигировали в плазмиду в соотношении 1: 3 путем инкубации с ДНК-лигазой Т4 при 16 ° C в течение ночи. Реакционную смесь лигирования использовали непосредственно для трансформации плазмиды в DH5-alfa E.coli (NEB) с использованием стандартной процедуры теплового шока. Трансформированные бактерии высевали на LB-агар с канамицином (Kan, 50 мкг / мл) и инкубировали в течение ночи при 37 ° C. Отбирали отдельные колонии и инокулировали в LB-Kan (50 мкг / мл) в течение ночи при 37 ° C при энергичном встряхивании. Плазмиды выделяли с использованием набора GeneJET для плазмид miniprep (ThermoFischer Scientific) перед проверкой секвенированием в GATC-Biotech. Плазмиды с положительной последовательностью (~ 1 мкг) трансформировали в химически компетентные HT115 (DE3) E.coli собственного производства, и клоны с положительной трансформацией отбирали с использованием чашек с LB-агаром с Кан (50 мкг / мл) и тетрациклином (Tet, 12,5 мкг / мл), как описано в Hull and Timmons 51 .

    Процедура культивирования и установка

    Ночная (ON) культура была получена путем инокуляции одиночных колоний HT115 (DE3) -pET28c-FRET в 3 мл LB с Kan (50 мкг / мл) и Tet (12,5 мкг / мл) и позволили выращивать в аэробных условиях при 37 ° C при интенсивном встряхивании в течение ночи. Культуру разводили 1: 100 в LB-Kan и инкубировали в тех же условиях до OD 600 ~ 0.25–35 (~ 3 ч). Затем к половине образца добавляли IPTG (1 мМ) и инкубировали культуры в течение ~ 6–9 ч. Добавляли DFHBI-1T (50 мкМ) и YO3-биотин (85 мкМ), и культуры инкубировали в течение 30 мин. Различные культуры осаждали центрифугированием при 4000 × g в течение 5 минут перед ресуспендированием в свежей соли 1 × M9 (Sigma # M6030) и анализировали с помощью спектрофлуорометрии, проточной цитометрии или конфокальной микроскопии.

    Спектрофлуориметрические измерения

    Клетки, полученные, как описано выше, анализировали спектрофлуориметрическими измерениями в объеме 50 мкл. Были приготовлены образцы, содержащие как DFHBI-1T, так и YO3-биотин, а также контроли, содержащие только DFHBI-1T или YO3-биотин. Возбуждение DFHBI-1T и YO3-биотина проводили при 450 и 580 нм соответственно. Выходы FRET были рассчитаны путем первого расчета возбуждения прямого акцептора, которое составило 1,5% (см. Дополнительную таблицу 2) от общего выброса YO3-биотина с использованием уравнения: \ (A _ {\ rm {dir}} = \ frac { {I _ {\ rm {Y}} (ex _ {\ rm {D}}, em _ {\ rm {Y}})} {{I _ {\ rm {Y}} (ex _ {\ rm {Y}}, em _ {\ rm {Y}})}} \), где \ (I_Y (ex_D, em_Y) \) — это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T с присутствием только YO3-биотина, а I Y ( ex Y , em Y ) представляет собой излучение на длине волны YO3-биотина после возбуждения YO3-биотина с присутствием только YO3-биотина.Далее была найдена интенсивность излучения, возникающего из хвоста DFHBI-1T на длине волны YO3-биотина; он был рассчитан как 7,4% (дополнительная таблица 2) от максимального выброса DFHBI-1T с использованием уравнения: \ (D _ {\ rm {утечка}} = \ frac {{I _ {\ rm {D}} (ex _ {\ rm {D}}, em _ {\ rm {D}})}} {{I _ {\ rm {D}} (ex _ {\ rm {D}}, em _ {\ rm {Y}})}} \) , где I D ( ex D , em D ) — это излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T при наличии только DFHBI-1T, и I ( ex D , em Y ) — это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T при наличии только DFHBI-1T. \ ast I _ {\ rm {DY}} (ex _ {\ rm {D}}, em _ {\ rm {D}}) + I _ {\ rm {DY}} (ex _ {\ rm {D}}, em_ { \ rm {D}})}} \), где \ (I _ {\ rm {DY}} (ex _ {\ rm {D}}, em _ {\ rm {Y}}) \) — эмиссия в YO3- длина волны биотина после возбуждения DFHBI-1T, \ (I _ {\ rm {DY}} (ex _ {\ rm {Y}}, em _ {\ rm {Y}}) \) — это излучение на длине волны YO3-биотина после YO3- возбуждения биотина, а \ (I _ {\ rm {DY}} (ex _ {\ rm {D}}, em _ {\ rm {D}}) \) — это излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T, все три с присутствием как DFHBI-1T, так и YO3-биотина.

    Проточная цитометрия

    Те же образцы, которые использовались для спектрофлуориметрических измерений (~ 50 мкл), разбавляли в 950 мкл соли 1 × M9 перед измерением на проточном цитометре Beckmann Coulter Gallios с лазером 488 нм и FL1 (575/30) и фильтры детектора FL3 (620/30).Для обработки данных использовалось программное обеспечение Kaluza Analysis. Эмиссию флуоресценции измеряли на 50 000 незащищенных клеток, содержащих как DFHBI-1T и YO3-биотин, так и только DFHBI-1T или YO3-биотин. Средние геометрические интенсивности закрытых клеток 2H-AE использовали в качестве фона и вычитали из средней геометрической интенсивности, измеренной на закрытых клетках, содержащих структуры apta-FRET. Интенсивность, возникающая из-за DFHBI-1T в канале FL3, была найдена с помощью \ (D _ {{\ rm {leak}}} = \ frac {{FL3 _ {\ rm {D}}}}} {{FL1 _ {\ rm {D} }}} \), где FL3 D и FL1 D — средние геометрические интенсивности в каналах FL3 и FL1, соответственно, из ячеек, содержащих только DFHBI-1T.\ ast FL1 _ {{\ rm {DY}}} + FL1 _ {{\ rm {DY}}}}} \), где \ (FL3 _ {{\ rm {DY}}} \) — выбросы YO3-биотина длина волны после возбуждения DFHBI-1T с присутствием как DFHBI-1T, так и YO3-биотина, \ (FL3 _ {\ rm {Y}} \) — это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T с присутствием только YO3-биотина, и \ (FL1 _ {\ rm {DY}} \) — это излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T с присутствием как DFHBI-1T, так и YO3-биотина.

    Флуоресцентная микроскопия

    Изображения флуоресцентной микроскопии получали с помощью Zeiss LSM 800 с масляным объективом 100X. Бактерии иммобилизовали на 96-луночных планшетах, покрытых поли-L-лизином (PLL) (µ-Plate, без покрытия, там же). 200 мкл PLL (10 мг / мл) вносили в лунки на 30 мин при 37 ° C, затем промывали свободной от нуклеаз H 2 O и сушили. В лунки добавляли 50 мкл культуры, приготовленной, как описано выше, в 1X солях M9, содержащих 100 мкМ DFHBI-1T и 17 мкМ YO3-биотин. DFHBI-1T возбуждали с использованием лазера 488 нм и регистрировали с использованием фильтра EGPF, а YO3-биотин возбуждали с помощью лазера 555 нм и регистрировали с использованием фильтра Texas Red.Сигнал FRET был получен путем возбуждения с использованием лазера 488 нм и записи с использованием техасского красного фильтра. Записанные изображения обрабатывались в MatLab (код доступен на нашей веб-странице www.andersen-lab.dk), где канал DFHBI-1T использовался для определения местоположения отдельных ячеек и определения их границ. Средняя интенсивность на пиксель в каждой ячейке была рассчитана для всех трех каналов. Клетки отбирали с использованием непосредственно возбуждаемой флуоресценции YO3-биотина и отбрасывали клетки с нижней 5% -ной интенсивностью, которая соответствует клеткам, не показывающим или показывающим очень низкую флуоресценцию YO3-биотина. Значения из каналов FRET и DFHBI-1T остальных ячеек использовались для расчета относительных выходов FRET с помощью уравнения \ ({\ rm {FRET}} = \ frac {{{I _ {\ mathrm {DY}}} ( {ex _ {\ mathrm D}}, {em _ {\ mathrm Y}})}} {{{I _ {\ mathrm {DY}}} ({ex _ {\ mathrm D}}, {em _ {\ mathrm Y}}) )} + {{I _ {\ mathrm {DY}}} ({ex _ {\ mathrm D}}, {em _ {\ mathrm D}})}} \), где \ (I _ {\ mathrm {DY}} { ({ex _ {\ mathrm D}}, {em _ {\ mathrm Y}})} \) — это излучение на длине волны YO3-биотина (техасский красный фильтр) после возбуждения DFHBI-1T и \ (I _ {\ mathrm {DY} } {({ex _ {\ mathrm {D}}}, {em _ {\ mathrm D}})} \) — излучение на длине волны DFHBI-1T (фильтр EGFP) после возбуждения DFHBI-1T.Оба были измерены с присутствием DFHBI-1T и YO3-биотина. Тепловая карта FRET была создана путем вычисления относительного вывода FRET на пиксель в границах выбранных ячеек с использованием того же уравнения.

    Доступность данных

    Авторы заявляют, что основные данные, подтверждающие выводы этого исследования, доступны в статье и файле с дополнительной информацией к ней. Дополнительные данные можно получить у соответствующего автора по запросу.

    Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    инвесторов обеспокоены тем, что Байден нацелился на 100-летнюю налоговую лазейку

    Использование механизма отсрочки налогов также дает возможность ликвидировать разрыв в национальном богатстве, на который было сосредоточено внимание после убийства Джорджа Флойда и последовавших за ним беспорядков. сказал Уильям Браун, основатель Springhill Real Estate Partners.Фирма является синдикатором, который объединяет аналогичные доходы от обмена и деньги от более мелких инвесторов для инвестирования в квартиры на Западе и Северо-Западе. В целом, подобные обмены позволяют этим инвесторам переходить от дуплексов к четырем, а затем от четырехкомплексов к более крупным жилым комплексам и так далее, сказал он.

    «Все больше и больше меньшинств хотят стать инвесторами в недвижимость, потому что они видят выгоду в увеличении богатства и доходов», — сказал г-н Браун, афроамериканец и бывший президент Национальной ассоциации риэлторов.«Избавление от биржи 1031 ограничит их возможности сделать это, потому что большинство инвесторов не могут позволить себе продать недвижимость, а затем купить что-то еще после уплаты налогов».

    Раздел 1031 также поощряет повторное использование зданий, поскольку инвесторы часто сосредотачиваются на добавлении стоимости более старым объектам, требующим ремонта, сказал Карлин Конклин, директор и сопрезидент Investors Management Group, еще одного синдикатора, инвестирующего в квартиры. В 2017 году Investors Management заплатила 19 миллионов долларов за недвижимость на 136 квартир в пригороде Портленда, штат Орегон. , и вложил в него дополнительно 1,5 миллиона долларов, чтобы построить клуб и провести другие улучшения.

    «Мы сделали этот жилой комплекс намного лучше, чтобы жить в нем, и построили намного лучшее здание в районе», — сказала г-жа Конклин, которая вместе со своим мужем лично инвестирует в недвижимость более 20 лет. «Без бирж будет меньше денег, выделяемых на улучшение старых объектов недвижимости, которые нуждаются в вливании капитала».

    В предложении о пересмотре статьи 1031 нет ничего нового — аналогичные идеи всплыли после президентских выборов, но потерпели неудачу.Однако в 2017 году снижение налогов при Трампе исключило обмен машин, транспортных средств и другого личного имущества из этого положения.

    На этой сессии Конгресса демократы, похоже, уделяют огромное внимание созданию более справедливого налогового кодекса наряду с инвестированием в инфраструктуру и социальные программы, сказал Стив Вамхофф, директор по федеральной налоговой политике в Институте налогообложения и экономической политики, некоммерческой группы.

    Добавить комментарий

    Ваш адрес email не будет опубликован.